Skip to main content

Table 1 List of primers used for RT-qPCR

From: Blood–brain barrier and intestinal epithelial barrier alterations in autism spectrum disorders

Gene Accession number 5′ OLIGO 3′ OLIGO Gene function in the brain/gut context
CLDN-1 NM_021101 GTGATAGCAATCTTTGTGGC ACTAAAATAGCCAGACCTGC Barrier-forming claudin
CLDN-5 NM_001130861 GAACTTCCTGAAGTGGTGTC CCAGACCTCTCAATCTTCAC Barrier-forming claudin; endothelial cell-specific
CLDN-12 NM_001185072 GAGAAGCAGGCTCAGATTAT AGATTCAGAACTTCCCTGTG Function at BBB unknown
OCLN U53823 CACACCACACCTACACTC TCCAAGATAAACCAATCTGCT Barrier-forming component of the TJs
VE-Cad X79981 AGTTCTTCCGAGTCACAAAA TCAGGTTATACCAGGGGTAG Main integral membrane protein of endothelial AJs; controls endothelial cell survival, stabilization of blood vessel assembly, and vascular permeability
MMP-9 NM_004994 TGTACCGCTATGGTTACACTCG GGCAGGGACAGTTGCTTCT Metalloprotease involved in local proteolysis of the extracellular matrix and in leukocyte migration
MMP-2 NM_004530 TACAGGATCATTGGCTACACACC GGTCACATCGCTCCAGACT Metalloprotease involved in local proteolysis of the extracellular matrix and in leukocyte migration
tPA NM_001319189 CCGGCTACGGCAAGCA AGCGGCTGGATGGGTACA Serine protease involved in the synthesis of MMPs and BBB damage
18S X03205 AGAAACGGCTACCACATCCA CCCTCCAATGGATCCTCGTT Ribosomal RNA (control gene for qPCR)
CLDN-2 NM_001171092 QIAGEN Pore-forming claudin; regulates paracellular ion and water flow
CLDN-3 NM_001306 QIAGEN Barrier-forming component of the TJs
CLDN-10 NM_001160100 QIAGEN Pore-forming claudin; regulates paracellular ion flow
CLDN-15 NM_001185080
NM_014343
NM_138429
QIAGEN Pore-forming claudin; regulates paracellular ion flow
TRIC NM_001038603 QIAGEN Barrier-forming component of the TJs
IL-1b NM_000576 QIAGEN Pro-inflammatory cytokine involved in increased BBB permeability
IL-6 NM_000600 QIAGEN Pro-inflammatory cytokine
IL-8 NM_000584 QIAGEN Pro-inflammatory cytokine
IL-10 NM_000572 QIAGEN Anti-inflammatory cytokine
TSPO NM_000714 QIAGEN Mitochondrial protein expressed on reactive glial cells; biomarker for inflammation in the brain
tTG6 NM_001254734 QIAGEN Marker of gluten-related neuroinflammation
MSFD2A NM_001136493 QIAGEN Key regulator of BBB function; required for the establishment of a functional BBB
IBA-1 NM_001623 QIAGEN Marker of microglia activation