Skip to main content

Advertisement

Table 2 Primers used for qRT-PCR

From: Altered glial marker expression in autistic post-mortem prefrontal cortex and cerebellum

Primer name Primer sequence (5′ to 3′) OD MW % GC content Tm(°C)
ActinB-F AGAAAATCTGGCACCACACC 4.1 6064 50 60.4
ActinB-R AGAGGCGTACAGGGATAGCA 4.3 6240.1 55 62.4
Trem2-F CCGGCTGCTCATCTTACTCT 3.3 5995 55 62.4
Trem2-R AGTCATAGGGGCAAGACACC 4.2 6160 55 62.4
Dap12-F GAGACCGAGTCGCCTTATCA 3.8 6102 55 62.4
Dap12-R GTCATGATTCGGGCTCATTT 3.7 6114.1 45 58.4
Cx3cr1-F GCAGATCCAGAGGTTCCCTT 3.7 6093 55 62.4
Cx3cr1-R TAACAGGCCTCAGCCAAATC 3.9 6055 50 60.4
Gfap-F CTGCGGCTCGATCAACTCA 3.5 5748.8 57.9 62.3
Gfap-R TCCAGCGACTCAATCTTCCTC 3.6 6277.1 52.4 62.7
Nefl-F AGCTGGAGGACAAGCAGAAC 4.4 6209.1 55 62.4
Nefl-R TGCCATTTCACTCTTTGTGG 3.5 6065 45 58.4
Parvalbumin-F CTGGAGACAAAGATGGGGAC 4.3 6240.1 55 62.4
Parvalbumin-R CAGAGAGGTGGAAGACCAGG 4.4 6265.1 60 64.5
Aif1-F AGCAGTGATGAGGATCTGCC 4.0 6182.1 55 62.4
Aif1-R AGCATTCGTTTCAGGGACAT 3.9 6132.1 45 58.4
  1. F: Forward; R: Reverse; OD: Optical density; MW: Molecular weight; Tm: Melting temperature.