Skip to main content

Table 1 Oligonucleotides used in this study

From: Non-synonymous single-nucleotide variations of the human oxytocin receptor gene and autism spectrum disorders: a case–control study in a Japanese population and functional analysis

Nucleotide sequencing Real-time PCR-based genotyping Site-directed mutagenesis EGFP tagging
  Amplification TaqMan MGB probes   
FWD1: TGGACTCAGCAGATCCGTCCG FWD8: GCTCCGCCAGCTACCTGAAG 376G-FAM: TGAGCCATGGCAGCTCC R376G-FWD: CCTTTGTCCTGAGCCATG GCAGCTCCAGCCAGAGG EGFP-FWD: CCGCAGGTGCACATCTTCTC
FWD2: CTAAGCATCGCCGACCTGGT REV7: TGGTGGGTCACGCCGTGGAT 376R-VIC: TGAGCCATCGCAGCTCC R376G-REV: CCTCTGGCTGGAGCTGCC ATGGCTCAGGACAAAGG EGFP-REV: GTGGATCCCGCCGTGGATGG
FWD3: CCGCAGGTGCACATCTTCTC   376C-FAM: TGAGCCATTGCAGCTCC R376C-FWD: CCTTTGTCCTGAGCCATT GCAGCTCCAGCCAGAGG  
FWD4: TGGAGTCTCCAGGAGTGGA    R376C-REV: CCTCTGGCTGGAGCTGCA ATGGCTCAGGACAAAGG  
FWD5: GTCTGGAAGTGGCTCCAGTG     
REV1: CCTGGACATTCTGAGGCAGC     
REV2: GATGAGCTTGACGCTGCTGAC     
REV3: GTCAGCAGCGTCAAGCTCATC     
REV4: CAGTCGAAGACGCCGTC     
REV5: ACATGAGCAGCAGCAGG     
REV6: CAGGAGCAGGATGAGAC     
  1. All sequences are given in the 5' to 3' direction. Nucleotides for rs35062132 are underlined. C, cysteine; FWD, forward; G, glycine; MGB, minor groove binder; R, arginine; REV, reverse.