Skip to main content

Table 2 Primer sequences for HOXB1 gene PCR amplification and DHPLC analysis.

From: Candidate gene study of HOXB1 in autism spectrum disorder

Exon Primer name Primer sequences (5'-3') Amplicon size (bp) PCR annealing temp (°C) DHPLC oven temp (°C)
1 HOXB1-F1 for CATACTGCCGAAAGGTTGTAG 365 60 61.5, 65.6, 66.2
  HOXB1-F1 rev TAGTACTGAGAAGGCCCGTA    
1 HOXB1-F2 for GGTATGCTCCTGCCGCCTGCA 227 58 63.3, 65.5
  HOXB1-F2 rev ATCAGCATAGGCCGGTGCAA    
1 HOXB1-F3 for AGCATCCCCCTTATGGGAA 282 58 62.8
  HOXB1-F3 rev CTTACCTGTGTCTACCAGAG    
2 HOXB1-F4 for GAGAATTGACCTGGCCTTTC 359 60 62.9, 63.4
  HOXB1-F4 rev TGACAGAGCTGGGTGAGGCTT    
2 HOXB1-F5 for TTTGGTTCCAGAACCGACGA 300 60 64.0, 65.5
  HOXB1-F5 rev GGCAGCTCTAAACTGGACTT    
  1. PCR, polymerase chain reaction; DHPLC, denaturing high performance liquid chromatography; temp, temperature.