Skip to main content

Advertisement

Table 1 Real-time PCR primer and probe sequences for the pol xenotropic murine leukemia virus-related virus (XMRV) assay.

From: PCR and serology find no association between xenotropic murine leukemia virus-related virus (XMRV) and autism

Name Sequence (5'→3')1
pol (2794 to 3062)  
Primers  
   Forward GGGGATCAAGCCCCACATA
   Reverse GGTGGAGTCTCAGGCAGAAAA
Probe [6FAM] TGTTCCAGGGGGACTGGCAAGGTACCAccctgg [DABC]2,3
  1. 1Reference sequence was the VP62 XMRV strain (GenBank: EF185282.1).
  2. 2Lower case bases were added to form the stem.
  3. 3[6FAM] and [DABC] are the fluorophore FAM and the quencher Dabcyl, respectively.