Skip to main content

Table 1 Primer sequences and general conditions used to perform real-time qPCR

From: Neuroglia in the autistic brain: evidence from a preclinical model

GENE Primer (5′ → 3′) Annealing (°C) Efficiency (%) R 2
S100B Forward TCAGGGAGAGAGGGTGACAA 60 94.6 .998
Reverse ACACTCCCCATCCCCATCTT
GFAP Forward CGGCTCTGAGAGAGATTCGC 60 105.0 .989
Reverse GCAAACTTGGACCGATACCA
Olig2 Forward CCCGATGATCTTTTTCTGCC 60 98.8 .990
Reverse GCTTCTTATCTTTCTTGGTG
CD11b Forward N/A (Cod. qRnoCID0002800, Bio-Rad) 60 94.0 .990
Reverse
Iba1 Forward GTCCTTGAAGCGAATGCTGG 60 95.6 .994
Reverse CATTCTCAAGATGGCAGATC
HPRT Forward TCCCAGCGTCGTGATTAGTGA 60 98.3 .992
Reverse CCTTCATGACATCTCGAGCAAG
TBP Forward TGGGATTGTACCACAGCTCCA 60 99.7 .995
Reverse CTCATGATGACTGCAGCAAACC
  1. GFAP glial fibrillary acidic protein; CD11b cluster of differentiation 11b; HPRT hypoxanthine guanine phosphoribosyl transferase; TBP TATA-box binding protein