Skip to main content

Advertisement

Table 5 Primers used in bisulfite pyrosequencing

From: Decitabine alters the expression of Mecp2 isoforms via dynamic DNA methylation at the Mecp2 regulatory elements in neural stem cells

Mecp2 region Sequence
Region 1 F: 5′-TGGGTTTTATAATTAATGAAGGGTAA-3′
R: 5′-CGCCAGGGTTTTCCCAGTCACGACATTTTACCACAACCCTCTCT-3′
S: 5′-AGGTGTAGTAGTATATAGG-3′
Region 2 F: 5′-AGTTTGGGTTTTATAATTAATGAAGGG-3′
R: 5′-CGCCAGGGTTTTCCCAGTCACGACATTTTACCACAACCCTCTCT-3′
S: 5′-AAGGGTAATTTAGATAAAGAGTAAG-3′
Region 3 F: 5′-GGTGAATTATTTAGTAGGGAGGTTTTAA -3′
R: 5′-CGCCAGGGTTTTCCCAGTCACGACAAAAAAAAAACCAACCCCATTCAACTAC -3′
S: 5′-AGTAGGGAGGTTTTAATAG -3′
Region 4 F: 5’-GTTTTAAAAAGTTTTGGGAAAAGGTGTAGT -3′
R: 5′-CGCCAGGGTTTTCCCAGTCACGACCTAAACCCTAACATCCCAACTACCAT-3′
S: 5′-AGTTTAATGGGGATTTTTAATT -3′
Region 5 F: 5′-AGTAGAAGTTATTATTTGTGGTGTGTAT -3′
R: 5′-CGCCAGGGTTTTCCCAGTCACGACACTATATTACTTCCCAACTCAACTAATT -3′
S: 5′-AGAGGTGTAAGGATTTT -3′
Region 6 F: 5′-GAAGTAGGAAGAATTGAGTTTGAGGATAG -3′
R: 5′-CGCCAGGGTTTTCCCAGTCACGACATCTATACACTACCCACATATAATACC -3′
S: 5′-GTTTGAGGATAGTTTGAAT -3′
  1. F: Forward PCR primer, R: Reverse PCR primer (Biotinylated), S: Sequencing primer.