Skip to main content

Advertisement

Table 2 shRNA sequences used for knockdown experiments

From: Transcriptomic analysis of genetically defined autism candidate genes reveals common mechanisms of action

Gene GenBank accession number shRNA target sequence TaqMan assay ID
Mecp2 NM_010788 GCCGATCTGCTGGAAAGTATG Mm00465017_m1
Mef2a NM_001033713 GCCCTAATGCTTTGTCGTACA Mm00488963_m1
Mef2d NM_133665 GTAGCTCTCTGGTCACTCC Mm00504929_m1
Nlgn1 NM_138666 GCAGATTGCCTGAAGTTATGC Mm02344307_m1
Nlgn3 NM_172932 GGATATGGTGGATTGTCTTCG Mm01225953_m1
Pten NM_008960 GGACAAGTTCATGTACTTTGA Mm00477210_m1
Shank3 NM_021423 GGGAGAAGTTGGATGAGATCC Mm00498775_m1
Gapdh NM_008084 Not Applicable 4352339E
Luciferase (pGL3-Basic) U47295 AATTCAGCGGGAGCCACCTGA Not Applicable