Skip to main content

Table 3 Primer sequence for HOXB1 SNP genotyping.

From: Candidate gene study of HOXB1 in autism spectrum disorder

Exon Primer name Primer sequences (5'-3') Amplicon size (bp) PCR annealing temp (°C)
1 HOXB1-F1 for CATACTGCCGAAAGGTTGTAG 365 60
  HOXB1-F1 rev TAGTACTGAGAAGGCCCGTA   
1 HOXB1-F2 for GGTATGCTCCTGCCGCCTGCA 227 58
  HOXB1-F2 rev ATCAGCATAGGCCGGTGCAA   
1 IVS1+63 G/A-mut_for AAAGCATCTCTGCTTCCCCTGCGG 118 58
  IVS1+63G/A_rev GACCTCACCTGACCTGAGAC   
2 S291N-mut_for ACCTGAGCCGGGCCCGGAGGATG 366 58
  HOXB1-F5 rev GGCAGCTCTAAACTGGACTT   
  1. PCR, polymerase chain reaction; temp, temperature.